This is an old revision of the document!
Table of Contents
Bio-Tools-CodonOptTable
A codon quality check tool, it produces a Codon Optimization table to see the quality of each codon.
The simplest way of depiction is to plot the codon usage frequency that can be found in common codon usage tables. A more elaborate way to depict the codon quality is to convert the codon usage frequency into relative adaptiveness values. In contrast to the codon usage frequency the relative adaptiveness takes into account the number of codons which code for the respective amino acid.
http://kobesearch.cpan.org/htdocs/Bio-Tools-CodonOptTable/README.html
Installation from cpan
cpan>install Bio::Tools::CodonOptTable
depends on GD::Graph and Bio::Perl
http://search.cpan.org/~shardiwal/Bio-Tools-CodonOptTable-0.07/lib/Bio/Tools/CodonOptTable.pm
USES or Examples
You can use this module in the following ways
use Bio::Tools::CodonOptTable;
my $seqobj = Bio::Tools::CodonOptTable->new ( -seq => 'ATGGGGTGGGCACCATGCTGCTGTCGTGAATTTGGGCACGATGGTGTACGTGCTCGTAGCTAGGGTGGGTGGTTTG',
-id => 'GeneFragment-12',
-accession_number => 'Myseq1',
-alphabet => 'dna',
-is_circular => 1,
-genetic_code => 1,
);
B<#If you wanna read from file>
my $seqobj = Bio::Tools::CodonOptTable->new(-file => "contig.fasta",
-format => 'Fasta',
-genetic_code => 1,
);
B<#If you have Accession number and want to get file from NCBI>
my $seqobj = Bio::Tools::CodonOptTable->new(-ncbi_id => "J00522",
-genetic_code => 1,);
my $myCodons = $seqobj->rscu_rac_table();
if($myCodons)
{
for my $each_aa (@$myCodons)
{
print "Codon : ",$each_aa->{'codon'},"\t";
print "Frequency : ",$each_aa->{'frequency'},"\t";
print "AminoAcid : ",$each_aa->{'aa_name'},"\t";
print "RSCU Value : ",$each_aa->{'rscu'},"\t"; #Relative Synonymous Codons Uses
print "RAC Value : ",$each_aa->{'rac'},"\t"; #Relative Adaptiveness of a Codon
print "\n";
}
}
B<# To get the prefered codon list based on RSCU & RAC Values >
my $prefered_codons = $seqobj->prefered_codon($myCodons);
while ( my ($amino_acid, $codon) = each(%$prefered_codons) ) {
print "AminoAcid : $amino_acid \t Codon : $codon\n"; }
B<# To produce a graph between RSCU & RAC> # Graph output file extension should be GIF, we support GIF only
$seqobj->generate_graph($myCodons,"myoutput.gif");
Creating a gui for CodonOptTable
Here is a python script that provides a Graphical User Interface: You need to have wxpython installed on your system.
#!/usr/bin/python import wx import os import random class testgui(wx.Frame): def __init__(self, parent, id, title): wx.Frame.__init__(self, parent, id, title, size=(600,300)) # Menu stuff menubar =wx.MenuBar() menufile =wx.Menu() menuhelp =wx.Menu() self.SetMenuBar(menubar) menubar.Append(menufile, '&File') menubar.Append(menuhelp, '&Help') exitmenu =menufile.Append(-1, 'Quit', 'Exit Application') about =menuhelp.Append(-1, 'About', 'About us') #panel creation and sizer panel =wx.Panel(self, -1) hbsizer =wx.BoxSizer(wx.VERTICAL) self.orig_text =wx.TextCtrl(panel,-1,size=(250,150),style=wx.TE_MULTILINE) # self.orig_text =wx.TextCtrl(panel,-1) #Objects self.orig_label =wx.StaticText(panel,-1, 'Paste Your Sequence here:') ok_button =wx.Button(panel,-1,'Run CodonOptTable') cancel_button =wx.Button(panel,-1,'Clear') exit_button=wx.Button(panel,-1,'Exit') disp =wx.StaticText(panel,-1,'') vsizer1 =wx.BoxSizer(wx.HORIZONTAL) vsizer4 =wx.BoxSizer(wx.HORIZONTAL) vsizer5 =wx.BoxSizer(wx.HORIZONTAL) vsizer6 =wx.BoxSizer(wx.HORIZONTAL) vsizer2 =wx.BoxSizer(wx.HORIZONTAL) vsizer1.Add(self.orig_label,1,wx.CENTRE,10) vsizer2.Add(self.orig_text,1,wx.CENTRE,10) vsizer5.Add(ok_button,1,wx.RIGHT,1) vsizer5.Add(cancel_button,1,wx.RIGHT,1) vsizer5.Add(exit_button,1,wx.RIGHT,1) vsizer6.Add(disp,1,wx.CENTER,1) hbsizer.Add(vsizer1,0,wx.CENTER|wx.ALL,1) # hbsizer.Add(self.orig_text,0, wx.CENTER|wx.ALL,1) hbsizer.Add(vsizer2,0, wx.CENTER|wx.ALL,1) hbsizer.Add(vsizer4,0, wx.CENTER|wx.ALL,1) hbsizer.Add(vsizer5,0,wx.ALIGN_RIGHT|wx.RIGHT,1) hbsizer.Add(vsizer6,0,wx.CENTER,1) #events self.Bind(wx.EVT_BUTTON,self.executa,ok_button) self.Bind(wx.EVT_MENU, self.soja, exitmenu) self.Bind(wx.EVT_BUTTON,self.clear,cancel_button) self.Bind(wx.EVT_BUTTON,self.soja,exit_button) #panel.CreateStatusBar() panel.SetSizer(hbsizer) self.Centre() self.Show(True) def clear(self,event=None): self.orig_text.SetValue('') def soja(self, event=None): self.Close(True) def executa(self,event=None): recordid=random.randint(20,10055) originator=self.orig_text.GetValue() os.system('perl /home/obiero/codonopt/codonOpt-test.pl %s' %originator) wx.MessageBox('DONE! check the output in you folder', 'CodonOptTable Info') app =wx.App() testgui(None, -1, 'CodonOptTable GUI') app.MainLoop()
This is used together with the perl script:
#!/bin/perl use Bio::Tools::CodonOptTable; $sequence = $ARGV[0]; sub codon { my ($mysequence)=@_; print $mysequence; my $seqobj = Bio::Tools::CodonOptTable->new ( -seq => $mysequence, -id => 'GeneFragment-12', -accession_number => 'Myseq1', -alphabet => 'dna', -is_circular => 1, -genetic_code => 1, ); #my $seqobj = Bio::Tools::CodonOptTable->new(-file => $mysequence, # # -format => 'Fasta', # -genetic_code => 1, # ); my $myCodons = $seqobj->rscu_rac_table(); if($myCodons) { for my $each_aa (@$myCodons) { print "Codon : ",$each_aa->{'codon'},"\t"; print "Frequency : ",$each_aa->{'frequency'},"\t"; print "AminoAcid : ",$each_aa->{'aa_name'},"\t"; print "RSCU Value : ",$each_aa->{'rscu'},"\t"; #Relative Synonymous Codons Uses print "RAC Value : ",$each_aa->{'rac'},"\t"; #Relative Adaptiveness of a Codon print "\n"; } } while ( my ($amino_acid, $codon) = each(%$prefered_codons) ) { print "AminoAcid : $amino_acid \t Codon : $codon\n"; } $seqobj->generate_graph($myCodons,"/home/obiero/codonopt/myoutput.gif"); } codon($sequence);
<note warning> Note: You have to edit the paths to suite your setup. </note>
Usefull ReGex
Merge sequence lines using sed:
$ cat mysequencefile | tr -d '\n' > new_sequence_file
