ILRI Research Computing

User Tools

Site Tools

You are here: start » bio » tools » codonopttable
bio:tools:codonopttable

Differences

This shows you the differences between two versions of the page.

Link to this comparison view

Both sides previous revisionPrevious revision
Next revision		Previous revision
bio:tools:codonopttable [2009/11/06 09:59] – 172.26.0.166bio:tools:codonopttable [2010/06/30 19:52] (current) – 172.26.15.75
Line 6: Line 6:
  
 http://kobesearch.cpan.org/htdocs/Bio-Tools-CodonOptTable/README.html http://kobesearch.cpan.org/htdocs/Bio-Tools-CodonOptTable/README.html
-http://search.cpan.org/~shardiwal/Bio-Tools-CodonOptTable-0.07/lib/Bio/Tools/CodonOptTable.pm+
  
 Installation from cpan Installation from cpan
 <code>cpan>install  Bio::Tools::CodonOptTable</code> <code>cpan>install  Bio::Tools::CodonOptTable</code>
-depends on GD::Graph and Bio::Perl+depends on **GD::Graph** and **Bio::Perl** 
 + 
 +http://search.cpan.org/~shardiwal/Bio-Tools-CodonOptTable-0.07/lib/Bio/Tools/CodonOptTable.pm 
 + 
 +====USES or Examples==== 
 + 
 +You can use this module in the following ways 
 +<code> 
 +use Bio::Tools::CodonOptTable; 
 + 
 +my $seqobj = Bio::Tools::CodonOptTable->new ( -seq => 'ATGGGGTGGGCACCATGCTGCTGTCGTGAATTTGGGCACGATGGTGTACGTGCTCGTAGCTAGGGTGGGTGGTTTG', 
 + 
 +                                                -id  => 'GeneFragment-12', 
 +                                                -accession_number => 'Myseq1', 
 +                                                -alphabet => 'dna', 
 +                                                -is_circular => 1, 
 +                                                -genetic_code => 1, 
 +                                   ); 
 +</code> 
 +B<#If you wanna read from file> 
 +<code> 
 +my $seqobj = Bio::Tools::CodonOptTable->new(-file => "contig.fasta", 
 + 
 +                                             -format => 'Fasta', 
 +                                             -genetic_code => 1, 
 +                                             ); 
 +</code> 
 +B<#If you have Accession number and want to get file from NCBI> <code>my $seqobj = Bio::Tools::CodonOptTable->new(-ncbi_id => "J00522", 
 + 
 +-genetic_code => 1,); 
 + 
 +my $myCodons = $seqobj->rscu_rac_table(); 
 + 
 +if($myCodons) 
 + 
 +        { 
 +            for my $each_aa (@$myCodons) 
 +        { 
 +        print "Codon      : ",$each_aa->{'codon'},"\t"; 
 +        print "Frequency  : ",$each_aa->{'frequency'},"\t"; 
 +        print "AminoAcid  : ",$each_aa->{'aa_name'},"\t"; 
 +        print "RSCU Value : ",$each_aa->{'rscu'},"\t"; #Relative Synonymous Codons Uses 
 +        print "RAC Value  : ",$each_aa->{'rac'},"\t"; #Relative Adaptiveness of a Codon 
 +        print "\n"; 
 +        } 
 +        } 
 +</code> 
 +B<# To get the prefered codon list based on RSCU & RAC Values ><code> my $prefered_codons = $seqobj->prefered_codon($myCodons); 
 + 
 +while ( my ($amino_acid, $codon) = each(%$prefered_codons) ) { 
 + 
 +print "AminoAcid : $amino_acid \t Codon : $codon\n"; } 
 +</code> 
 +B<# To produce a graph between RSCU & RAC> # Graph output file extension should be GIF, we support GIF only 
 +<code> 
 +$seqobj->generate_graph($myCodons,"myoutput.gif");</code> 
 +====Creating a gui for CodonOptTable==== 
 + 
 +Here is a python script that provides a Graphical User Interface: 
 +You need to have wxpython installed on your system. 
 +<code python> 
 +#!/usr/bin/python 
 +import wx 
 +import os 
 +import random 
 +import re 
 +class testgui(wx.Frame): 
 +    def __init__(self, parent, id, title): 
 +        wx.Frame.__init__(self, parent, id, title, size=(683,360)) 
 +        # Menu stuff 
 +        menubar =wx.MenuBar() 
 +        menufile =wx.Menu() 
 +        menuhelp =wx.Menu() 
 +        self.SetMenuBar(menubar) 
 +        menubar.Append(menufile, '&File') 
 +        menubar.Append(menuhelp, '&Help') 
 +        exitmenu =menufile.Append(-1, 'Quit', 'Exit Application') 
 +        about =menuhelp.Append(-1, 'About', 'About us') 
 +        #panel creation and sizer 
 +        panel =wx.Panel(self, -1) 
 +        hbsizer =wx.BoxSizer(wx.VERTICAL) 
 +        self.orig_text =wx.TextCtrl(panel,-1,size=(679,275),style=wx.TE_MULTILINE) 
 +       # self.orig_text =wx.TextCtrl(panel,-1) 
 +       #Objects 
 +        self.orig_label =wx.StaticText(panel,-1, 'Paste Your Sequence here:') 
 +        ok_button =wx.Button(panel,-1,'Run CodonOptTable') 
 +        cancel_button =wx.Button(panel,-1,'Clear') 
 +        format_seq =wx.Button(panel,-1,'Format Seq') 
 +        rhead =wx.Button(panel,-1,'Remove Header') 
 +        exit_button=wx.Button(panel,-1,'Exit') 
 +        disp =wx.StaticText(panel,-1,'') 
 +      vsizer1 =wx.BoxSizer(wx.HORIZONTAL) 
 +      vsizer4 =wx.BoxSizer(wx.HORIZONTAL) 
 +      vsizer5 =wx.BoxSizer(wx.HORIZONTAL) 
 +      vsizer6 =wx.BoxSizer(wx.HORIZONTAL) 
 +      vsizer2 =wx.BoxSizer(wx.HORIZONTAL) 
 +  
 +      vsizer1.Add(self.orig_label,1,wx.CENTRE,10) 
 +      vsizer2.Add(self.orig_text,1,wx.CENTRE,10) 
 +  
 +      vsizer5.Add(rhead,1,wx.RIGHT,1) 
 +      vsizer5.Add(format_seq,1,wx.RIGHT,1) 
 +      vsizer5.Add(ok_button,1,wx.RIGHT,1) 
 +      vsizer5.Add(cancel_button,1,wx.RIGHT,1) 
 +      vsizer5.Add(exit_button,1,wx.RIGHT,1) 
 +  
 +      vsizer6.Add(disp,1,wx.CENTER,1) 
 +  
 +      hbsizer.Add(vsizer1,0,wx.CENTER|wx.ALL,1) 
 +#       hbsizer.Add(self.orig_text,0, wx.CENTER|wx.ALL,1) 
 +      hbsizer.Add(vsizer2,0, wx.CENTER|wx.ALL,1) 
 +      hbsizer.Add(vsizer4,0, wx.CENTER|wx.ALL,1) 
 +      hbsizer.Add(vsizer5,0,wx.ALIGN_RIGHT|wx.RIGHT,1) 
 +      hbsizer.Add(vsizer6,0,wx.CENTER,1) 
 +  
 + #events 
 +      self.Bind(wx.EVT_BUTTON,self.executa,ok_button) 
 +      self.Bind(wx.EVT_BUTTON,self.rheader,rhead) 
 +      self.Bind(wx.EVT_BUTTON,self.format_seq,format_seq) 
 +      self.Bind(wx.EVT_MENU, self.soja, exitmenu) 
 +      self.Bind(wx.EVT_BUTTON,self.clear,cancel_button) 
 +      self.Bind(wx.EVT_BUTTON,self.soja,exit_button) 
 +#pane l.CreateStatusBar() 
 +      panel.SetSizer(hbsizer)  
 +      self.Centre() 
 +      self.Show(True) 
 +    def clear(self,event=None): 
 + self.orig_text.SetValue('') 
 +    def format_seq(self,event=None): 
 + originator=self.orig_text.GetValue() 
 + comm=re.sub('[ \t\r\n]','',originator) 
 +        self.orig_text.SetValue(comm) 
 +    def rheader(self,event=None): 
 + originator=self.orig_text.GetValue() 
 + comm=re.sub('>.*','>',originator) 
 +        self.orig_text.SetValue(comm) 
 +    def soja(self, event=None): 
 +    self.Close(True) 
 +    def executa(self,event=None): 
 + recordid=random.randint(20,10055) 
 + originator=self.orig_text.GetValue() 
 + os.system('perl /home/obiero/codonopt/codonOpt-test.pl %s' %originator) 
 + wx.MessageBox('DONE! check the output in you folder', 'CodonOptTable Info')     
 +app =wx.App() 
 +testgui(None, -1, 'CodonOptTable GUI') 
 +app.MainLoop() 
 + 
 +</code> 
 +This is used together with the perl script: 
 +<code perl>#!/bin/perl 
 +use Bio::Tools::CodonOptTable; 
 +$sequence = $ARGV[0]; 
 +sub codon { 
 +my ($mysequence)=@_; 
 +print $mysequence; 
 +my $seqobj = Bio::Tools::CodonOptTable->new ( -seq => $mysequence, 
 +                                                -id  => 'GeneFragment-12', 
 +                                                -accession_number => 'Myseq1', 
 +                                                -alphabet => 'dna', 
 +                                                -is_circular => 1, 
 +                                                -genetic_code => 1, 
 +                                   ); 
 +#my $seqobj = Bio::Tools::CodonOptTable->new(-file => $mysequence, 
 +# 
 +#                                             -format => 'Fasta', 
 +#                                             -genetic_code => 1, 
 +#                                             ); 
 +my $myCodons = $seqobj->rscu_rac_table(); 
 + 
 +if($myCodons) 
 + 
 +        {    
 +            for my $each_aa (@$myCodons) 
 +        { 
 +        print "Codon      : ",$each_aa->{'codon'},"\t"; 
 +        print "Frequency  : ",$each_aa->{'frequency'},"\t"; 
 +        print "AminoAcid  : ",$each_aa->{'aa_name'},"\t"; 
 +        print "RSCU Value : ",$each_aa->{'rscu'},"\t"; #Relative Synonymous Codons Uses 
 +        print "RAC Value  : ",$each_aa->{'rac'},"\t"; #Relative Adaptiveness of a Codon 
 +        print "\n"; 
 +        } 
 +        } 
 + 
 + while ( my ($amino_acid, $codon) = each(%$prefered_codons) ) { 
 + 
 +print "AminoAcid : $amino_acid \t Codon : $codon\n"; } 
 +$seqobj->generate_graph($myCodons,"/home/obiero/codonopt/myoutput.gif"); 
 +} 
 +codon($sequence); </code> 
 +<note warning> Note: You have to edit the paths to suite your setup. </note> 
 + 
 +==== Usefull ReGex ==== 
 +---- 
 +Merge sequence lines using sed:  
 + 
 +<code>$ grep -v Tp sequence | tr -d "\n" > new_sequence_file</code>
  
 +<code>$ grep -o <pattern> </code> This will grep only the part of matching line that matching the pattern eg How many occurence of "ATCG"  in a sequence?
bio/tools/codonopttable.txt · Last modified: 2010/06/30 19:52 by 172.26.15.75