Differences

This shows you the differences between two versions of the page.

--- bio:tools:codonopttable [2009/11/06 09:59] – 172.26.0.166
+++ bio:tools:codonopttable [2010/05/22 14:19] – external edit 127.0.0.1
@@ Line 6: / Line 6: @@
 http://kobesearch.cpan.org/htdocs/Bio-Tools-CodonOptTable/README.html
-http://search.cpan.org/~shardiwal/Bio-Tools-CodonOptTable-0.07/lib/Bio/Tools/CodonOptTable.pm
 Installation from cpan
 <code>cpan>install  Bio::Tools::CodonOptTable</code>
-depends on GD::Graph and Bio::Perl
+depends on **GD::Graph** and **Bio::Perl**
+http://search.cpan.org/~shardiwal/Bio-Tools-CodonOptTable-0.07/lib/Bio/Tools/CodonOptTable.pm
+====USES or Examples====
+You can use this module in the following ways
+<code>
+use Bio::Tools::CodonOptTable;
+my $seqobj = Bio::Tools::CodonOptTable->new ( -seq => 'ATGGGGTGGGCACCATGCTGCTGTCGTGAATTTGGGCACGATGGTGTACGTGCTCGTAGCTAGGGTGGGTGGTTTG',
+                                                -id  => 'GeneFragment-12',
+                                                -accession_number => 'Myseq1',
+                                                -alphabet => 'dna',
+                                                -is_circular => 1,
+                                                -genetic_code => 1,
+                                   );
+</code>
+B<#If you wanna read from file>
+<code>
+my $seqobj = Bio::Tools::CodonOptTable->new(-file => "contig.fasta",
+                                             -format => 'Fasta',
+                                             -genetic_code => 1,
+                                             );
+</code>
+B<#If you have Accession number and want to get file from NCBI> <code>my $seqobj = Bio::Tools::CodonOptTable->new(-ncbi_id => "J00522",
+-genetic_code => 1,);
+my $myCodons = $seqobj->rscu_rac_table();
+if($myCodons)
+        {
+            for my $each_aa (@$myCodons)
+        {
+        print "Codon      : ",$each_aa->{'codon'},"\t";
+        print "Frequency  : ",$each_aa->{'frequency'},"\t";
+        print "AminoAcid  : ",$each_aa->{'aa_name'},"\t";
+        print "RSCU Value : ",$each_aa->{'rscu'},"\t"; #Relative Synonymous Codons Uses
+        print "RAC Value  : ",$each_aa->{'rac'},"\t"; #Relative Adaptiveness of a Codon
+        print "\n";
+        }
+        }
+</code>
+B<# To get the prefered codon list based on RSCU & RAC Values ><code> my $prefered_codons = $seqobj->prefered_codon($myCodons);
+while ( my ($amino_acid, $codon) = each(%$prefered_codons) ) {
+print "AminoAcid : $amino_acid \t Codon : $codon\n"; }
+</code>
+B<# To produce a graph between RSCU & RAC> # Graph output file extension should be GIF, we support GIF only
+<code>
+$seqobj->generate_graph($myCodons,"myoutput.gif");</code>
+====Creating a gui for CodonOptTable====
+Here is a python script that provides a Graphical User Interface:
+You need to have wxpython installed on your system.
+<code python>
+#!/usr/bin/python
+import wx
+import os
+import random
+class testgui(wx.Frame):
+    def __init__(self, parent, id, title):
+        wx.Frame.__init__(self, parent, id, title, size=(600,300))
+        # Menu stuff
+        menubar =wx.MenuBar()
+        menufile =wx.Menu()
+        menuhelp =wx.Menu()
+        self.SetMenuBar(menubar)
+        menubar.Append(menufile, '&File')
+        menubar.Append(menuhelp, '&Help')
+        exitmenu =menufile.Append(-1, 'Quit', 'Exit Application')
+        about =menuhelp.Append(-1, 'About', 'About us')
+        #panel creation and sizer
+        panel =wx.Panel(self, -1)
+        hbsizer =wx.BoxSizer(wx.VERTICAL)
+        self.orig_text =wx.TextCtrl(panel,-1,size=(250,150),style=wx.TE_MULTILINE)
+       # self.orig_text =wx.TextCtrl(panel,-1)
+#Objects
+        self.orig_label =wx.StaticText(panel,-1, 'Paste Your Sequence here:')
+	ok_button =wx.Button(panel,-1,'Run CodonOptTable')
+	cancel_button =wx.Button(panel,-1,'Clear')
+	exit_button=wx.Button(panel,-1,'Exit')
+	disp =wx.StaticText(panel,-1,'')
+	vsizer1 =wx.BoxSizer(wx.HORIZONTAL)
+	vsizer4 =wx.BoxSizer(wx.HORIZONTAL)
+	vsizer5 =wx.BoxSizer(wx.HORIZONTAL)
+	vsizer6 =wx.BoxSizer(wx.HORIZONTAL)
+	vsizer2 =wx.BoxSizer(wx.HORIZONTAL)
+	vsizer1.Add(self.orig_label,1,wx.CENTRE,10)
+	vsizer2.Add(self.orig_text,1,wx.CENTRE,10)
+	vsizer5.Add(ok_button,1,wx.RIGHT,1)
+	vsizer5.Add(cancel_button,1,wx.RIGHT,1)
+	vsizer5.Add(exit_button,1,wx.RIGHT,1)
+	vsizer6.Add(disp,1,wx.CENTER,1)
+	hbsizer.Add(vsizer1,0,wx.CENTER|wx.ALL,1)
+#	hbsizer.Add(self.orig_text,0, wx.CENTER|wx.ALL,1)
+	hbsizer.Add(vsizer2,0, wx.CENTER|wx.ALL,1)
+	hbsizer.Add(vsizer4,0, wx.CENTER|wx.ALL,1)
+	hbsizer.Add(vsizer5,0,wx.ALIGN_RIGHT|wx.RIGHT,1)
+	hbsizer.Add(vsizer6,0,wx.CENTER,1)
+	#events
+	self.Bind(wx.EVT_BUTTON,self.executa,ok_button)
+	self.Bind(wx.EVT_MENU, self.soja, exitmenu)
+	self.Bind(wx.EVT_BUTTON,self.clear,cancel_button)
+	self.Bind(wx.EVT_BUTTON,self.soja,exit_button)
+	#panel.CreateStatusBar()
+	panel.SetSizer(hbsizer)
+	self.Centre()
+        self.Show(True)
+    def clear(self,event=None):
+	self.orig_text.SetValue('')
+    def soja(self, event=None):
+        self.Close(True)
+    def executa(self,event=None):
+	recordid=random.randint(20,10055)
+	originator=self.orig_text.GetValue()
+	os.system('perl /home/obiero/codonopt/codonOpt-test.pl %s' %originator)
+	wx.MessageBox('DONE! check the output in you folder', 'CodonOptTable Info')
+app =wx.App()
+testgui(None, -1, 'CodonOptTable GUI')
+app.MainLoop()
+</code>
+This is used together with the perl script:
+<code perl>#!/bin/perl
+use Bio::Tools::CodonOptTable;
+$sequence = $ARGV[0];
+sub codon {
+my ($mysequence)=@_;
+print $mysequence;
+my $seqobj = Bio::Tools::CodonOptTable->new ( -seq => $mysequence,
+                                                -id  => 'GeneFragment-12',
+                                                -accession_number => 'Myseq1',
+                                                -alphabet => 'dna',
+                                                -is_circular => 1,
+                                                -genetic_code => 1,
+                                   );
+#my $seqobj = Bio::Tools::CodonOptTable->new(-file => $mysequence,
+#
+#                                             -format => 'Fasta',
+#                                             -genetic_code => 1,
+#                                             );
+my $myCodons = $seqobj->rscu_rac_table();
+if($myCodons)
+        {
+            for my $each_aa (@$myCodons)
+        {
+        print "Codon      : ",$each_aa->{'codon'},"\t";
+        print "Frequency  : ",$each_aa->{'frequency'},"\t";
+        print "AminoAcid  : ",$each_aa->{'aa_name'},"\t";
+        print "RSCU Value : ",$each_aa->{'rscu'},"\t"; #Relative Synonymous Codons Uses
+        print "RAC Value  : ",$each_aa->{'rac'},"\t"; #Relative Adaptiveness of a Codon
+        print "\n";
+        }
+        }
+ while ( my ($amino_acid, $codon) = each(%$prefered_codons) ) {
+print "AminoAcid : $amino_acid \t Codon : $codon\n"; }
+$seqobj->generate_graph($myCodons,"/home/obiero/codonopt/myoutput.gif");
+}
+codon($sequence); </code>
+<note warning> Note: You have to edit the paths to suite your setup. </note>
+==== Usefull ReGex ====
+----
+Merge sequence lines using sed:
+<code>$ grep -v Tp sequence | tr -d "\n" > new_sequence_file</code>
+<code>$ grep -o <pattern> </code> This will grep only the part of matching line that matching the pattern eg How many occurence of "ATCG"  in a sequence?