Differences

This shows you the differences between two versions of the page.

--- bio:tools:codonopttable [2009/11/06 10:00] – 172.26.0.166
+++ bio:tools:codonopttable [2009/12/17 09:45] – 172.26.15.75
@@ Line 13: / Line 13: @@
 http://search.cpan.org/~shardiwal/Bio-Tools-CodonOptTable-0.07/lib/Bio/Tools/CodonOptTable.pm
+====USES or Examples====
+You can use this module in the following ways
+<code>
+use Bio::Tools::CodonOptTable;
+my $seqobj = Bio::Tools::CodonOptTable->new ( -seq => 'ATGGGGTGGGCACCATGCTGCTGTCGTGAATTTGGGCACGATGGTGTACGTGCTCGTAGCTAGGGTGGGTGGTTTG',
+                                                -id  => 'GeneFragment-12',
+                                                -accession_number => 'Myseq1',
+                                                -alphabet => 'dna',
+                                                -is_circular => 1,
+                                                -genetic_code => 1,
+                                   );
+</code>
+B<#If you wanna read from file>
+<code>
+my $seqobj = Bio::Tools::CodonOptTable->new(-file => "contig.fasta",
+                                             -format => 'Fasta',
+                                             -genetic_code => 1,
+                                             );
+</code>
+B<#If you have Accession number and want to get file from NCBI> <code>my $seqobj = Bio::Tools::CodonOptTable->new(-ncbi_id => "J00522",
+-genetic_code => 1,);
+my $myCodons = $seqobj->rscu_rac_table();
+if($myCodons)
+        {
+            for my $each_aa (@$myCodons)
+        {
+        print "Codon      : ",$each_aa->{'codon'},"\t";
+        print "Frequency  : ",$each_aa->{'frequency'},"\t";
+        print "AminoAcid  : ",$each_aa->{'aa_name'},"\t";
+        print "RSCU Value : ",$each_aa->{'rscu'},"\t"; #Relative Synonymous Codons Uses
+        print "RAC Value  : ",$each_aa->{'rac'},"\t"; #Relative Adaptiveness of a Codon
+        print "\n";
+        }
+        }
+</code>
+B<# To get the prefered codon list based on RSCU & RAC Values > my $prefered_codons = $seqobj->prefered_codon($myCodons);
+while ( my ($amino_acid, $codon) = each(%$prefered_codons) ) {
+print "AminoAcid : $amino_acid \t Codon : $codon\n"; }
+B<# To produce a graph between RSCU & RAC> # Graph output file extension should be GIF, we support GIF only
+$seqobj->generate_graph($myCodons,"myoutput.gif");