User Tools

Site Tools


bio:tools:codonopttable

Differences

This shows you the differences between two versions of the page.

Link to this comparison view

Both sides previous revisionPrevious revision
Next revision
Previous revision
Next revisionBoth sides next revision
bio:tools:codonopttable [2009/11/06 09:43] 172.26.0.166bio:tools:codonopttable [2009/12/17 09:48] 172.26.15.75
Line 4: Line 4:
  
 The simplest way of depiction is to plot the codon usage frequency that can be found in common codon usage tables. A more elaborate way to depict the codon quality is to convert the codon usage frequency into relative adaptiveness values. In contrast to the codon usage frequency the relative adaptiveness takes into account the number of codons which code for the respective amino acid.  The simplest way of depiction is to plot the codon usage frequency that can be found in common codon usage tables. A more elaborate way to depict the codon quality is to convert the codon usage frequency into relative adaptiveness values. In contrast to the codon usage frequency the relative adaptiveness takes into account the number of codons which code for the respective amino acid. 
 +
 http://kobesearch.cpan.org/htdocs/Bio-Tools-CodonOptTable/README.html http://kobesearch.cpan.org/htdocs/Bio-Tools-CodonOptTable/README.html
 +
 +
 +Installation from cpan
 +<code>cpan>install  Bio::Tools::CodonOptTable</code>
 +depends on **GD::Graph** and **Bio::Perl**
 +
 +http://search.cpan.org/~shardiwal/Bio-Tools-CodonOptTable-0.07/lib/Bio/Tools/CodonOptTable.pm
 +
 +====USES or Examples====
 +
 +You can use this module in the following ways
 +<code>
 +use Bio::Tools::CodonOptTable;
 +
 +my $seqobj = Bio::Tools::CodonOptTable->new ( -seq => 'ATGGGGTGGGCACCATGCTGCTGTCGTGAATTTGGGCACGATGGTGTACGTGCTCGTAGCTAGGGTGGGTGGTTTG',
 +
 +                                                -id  => 'GeneFragment-12',
 +                                                -accession_number => 'Myseq1',
 +                                                -alphabet => 'dna',
 +                                                -is_circular => 1,
 +                                                -genetic_code => 1,
 +                                   );
 +</code>
 +B<#If you wanna read from file>
 +<code>
 +my $seqobj = Bio::Tools::CodonOptTable->new(-file => "contig.fasta",
 +
 +                                             -format => 'Fasta',
 +                                             -genetic_code => 1,
 +                                             );
 +</code>
 +B<#If you have Accession number and want to get file from NCBI> <code>my $seqobj = Bio::Tools::CodonOptTable->new(-ncbi_id => "J00522",
 +
 +-genetic_code => 1,);
 +
 +my $myCodons = $seqobj->rscu_rac_table();
 +
 +if($myCodons)
 +
 +        {
 +            for my $each_aa (@$myCodons)
 +        {
 +        print "Codon      : ",$each_aa->{'codon'},"\t";
 +        print "Frequency  : ",$each_aa->{'frequency'},"\t";
 +        print "AminoAcid  : ",$each_aa->{'aa_name'},"\t";
 +        print "RSCU Value : ",$each_aa->{'rscu'},"\t"; #Relative Synonymous Codons Uses
 +        print "RAC Value  : ",$each_aa->{'rac'},"\t"; #Relative Adaptiveness of a Codon
 +        print "\n";
 +        }
 +        }
 +</code>
 +B<# To get the prefered codon list based on RSCU & RAC Values ><code> my $prefered_codons = $seqobj->prefered_codon($myCodons);
 +
 +while ( my ($amino_acid, $codon) = each(%$prefered_codons) ) {
 +
 +print "AminoAcid : $amino_acid \t Codon : $codon\n"; }
 +</code>
 +B<# To produce a graph between RSCU & RAC> # Graph output file extension should be GIF, we support GIF only
 +<code>
 +$seqobj->generate_graph($myCodons,"myoutput.gif");</code>
 +
 +====Creating a gui for CodonOptTable====
 +
 +
bio/tools/codonopttable.txt · Last modified: by 172.26.15.75